Ремонт 2: Сколько стоит ремонт 2-комнатной квартиры под аренду?

Содержание

Ремонт двухкомнатной квартиры под ключ по цене от 5 590₽ за кв.м.

Демонтажные работы Ед. измер. Цена*
полы Демонтаж плинтуса м/п 58
полы Демонтаж ламината, паркетной доски м2 80
полы Демонтаж фанеры, ДВП м2 69
полы Демонтаж деревянных полов м2 178
полы Демонтаж лаг м2 91
полы Демонтаж стяжки до 3 см м2 281
стены Снятие обоев м2 71
стены Снятие побелки м2 138
стены Очистка краски со стен м2 138
стены Очистка стен от шпаклевки м2 138
стены Ошкуривание поверхности м2 100
стены Отбивка штукатурки со стен м2 223
стены Демонтаж стен (перегородок) из кирпича м2 566
стены Демонтаж стен из ацеида, гипсолита, ГКЛ м2 338
потолки Демонтаж натяжного потолка м2 69
потолки Демонтаж подвесных потолков ГКЛ м2 166
потолки Очистка побелки м2 183
потолки Очистка краски ВЭ м2 149
потолки Снятие обоев м2 71
двери Демонтаж деревянной двери м2 366
окна Демонтаж оконного блока м2 452
окна Демонтаж подоконников м/п 263
прочие Демонтаж вент решеток шт 69
прочие Демонтаж воздуховодов м 138
прочие Очистка радиатора от краски шт 1133
сантех Демонтаж смесителя шт 279
сантех Демонтаж душевой кабины шт 749
сантех Демонтаж ванны шт 869
сантех Демонтаж раковины шт 434
сантех Демонтаж унитаза шт 566
сантех Демонтаж полотенцесушителя шт 543
сантех Демонтаж труб в/с м/п 208
сантех Демонтаж труб канализации м/п 263
Электрика Ед. измер. Цена*
электр Демонтаж розеток и выключателей шт 98
электр Демонта люстры шт 246
электр Демонтаж электрокабеля м 23
Черновые отделочные работы Ед. измер. Цена*
полы Грунтовка пола м2 52
полы Устройство наливных полов м2 304
полы Устройство стяжки по маякам м2 434
полы Устройство тепло/звукоизоляции м2 160
полы Укладка фанеры м2 270
стены Штукатурка стен по маякам гипсовой смесью м2 511
стены Штукатурка стен (под правило) м2 396
стены Грунтовка стен м2 52
стены Шпатлевка стен под оклейку обоями (с ошкуриванием) м2 331
стены Устройство перегородок из ГКЛ м2 652
откосы Грунтовка откосов, углов м/п 50
откосы Штукатурка откосов м/п 350
откосы Утепление откосов м/п 98
потолки Штукатурка потолка по маякам м2 592
потолки Грунтовка потолков м2 73
потолки Шпатлевка потолков под покраску м2 565
Чистовые отделочные работы Ед. измер. Цена*
полы Укладка ламината м2 378
полы Укладка паркетной доски м2 459
полы Настил линолеума бытового, ковролина м2 258
полы Монтаж плинтусов м/п 143
стены Оклейка стен обоями м2 290
стены Облицовка плиткой стен м2 876
стены Облицовка стен ПВХ панелями (свыше 10м2) м2 515
стены Окраска стен в 2 слоя м2 223
откосы Окраска откосов, углов м/п 173
потолки Окраска потолков м2 258
потолки Устройство натяжных потолков м2 330
двери Установка двери деревянной шт 3850
двери Установка двери металлической шт 5940
окна Окраска окна м2 572
окна Установка подоконников м/п 686
электр Установка розеток шт 258
электр Прокладка кабеля м/п 66
электр Установка люстры шт 824
электр Установка звонка шт 361
сантех Установка ванны шт 3587
сантех Установка раковины шт 1304
сантех Установка унитаза шт 2174
сантех Установка душа шт 626
сантех Прокладка труб водоснабжения м/п 326
сантех Прокладка труб канализации м/п 486
Подготовительные работы Ед. измер. Цена*
подг Укрытие пленкой м2 18
груз Разгрузка материала т 1716

Ремонт 2-комнатной квартиры под ключ по низкой цене в Москве от СК «НОВАЯ МОСКВА»

ПОДГОТОВИТЕЛЬНЫЕ И ДЕМОНТАЖНЫЕ РАБОТЫ
Демонтаж стен из гипса армированного 250 кв.м.
Демонтаж стен из ацеита 200 кв.м.
Демонтаж стен из пеноблоков 450 кв.м.
Снос стен бетонных (межкомнатных перегородок толщиной до 8 см) 800 кв. м.
Снос стен бетонных (межкомнатных перегородок толщиной от 8 до10 см) 1000 кв.м.
Демонтаж сантехкабины (комплекс) 14900 шт.
Демонтаж подоконной части из бетона 7500 кв.м.
Демонтаж подоконной части из кирпича 5500 кв.м.
Демонтаж подоконной части из пенобетона 2300 кв.м.
Расширение дверного проема в бетоне 1200 пог. м.
Устройство проема под двери, арки и т д: в кирпиче (1/2 кирпича) 1750 кв.м.
Усиление проема в несущей стене швеллером (уголком) 2100 пог.м.
Демонтаж сухой штукатурки установленной на гипс или цементную смесь 120 кв.м.
Демонтаж старой штукатурки из цементно-песчаного раствора 250 кв.м.
Демонтаж керамической плитки 240 кв.м.
Демонтаж внутренних межкомнатных перегородок из дерева 290 кв. м.
Демонтаж деревянных встроенных шкафов, ниш, антресолей и т д 180 кв.м.
Очистка стен от старых обоев 120 кв.м.
Очистка стен от масляной краски, шпатлевки 180 кв.м.
Штробление бетонной стены шириной до 15 см 800 пог.м.
Штробление кирпичной стены шириной до 15 см 600 пог.м.
Штробление стены из пенобетона или гипса шириной до 15 см 400 пог. м.
ДЕМОНТАЖ СТЕН ИЗ ПГП 450 кв.м.
ДЕМОНТАЖ ПВХ ПАНЕЛЕЙ 650 кв.м.
ДЕМОНТАЖ СЕНД.ПАНЕЛ. 100 пог.м.
ДЕМОНТАЖ ДВЕРЕЙ 500 шт.
УСТРОЙСТВО СТЕН
Кирпичная кладка в 1/4 кирпича 1100 кв.м.
Кирпичная кладка в 1/2 кирпича 800 кв. м.
Кирпичная кладка в 1 кирпич 1100 кв.м.
Устройство межкомнатных перегородок из пазогребневого блока 550 кв.м.
Устройство перегородок из пенобетонного (газосиликатного) блока толщ. 8-10 см 550 кв.м.
Устройство перегородок из пенобетонного (газосиликатного) блока толщ. 15-20 см 750 кв.м.
Кладка перегородок и окон из стеклоблоков 500 кв.м.
Монтаж перегородок из ГКЛ на металлическом каркасе в один слой 800 кв. м.
Монтаж перегородок из ГКЛ на металлическом каркасе в два слоя 1000 кв.м.
Монтаж гипсокартона на стену без каркасса в один слой 400 кв.м.
Монтаж гипсокартона на стену без каркасса в два слоя 500 кв.м.
Монтаж гипсокартона на стену с предварительной обрешеткой стены 650 кв.м.
ШТУКАТУРНЫЕ РАБОТЫ
Обработка стен грунтовкой глубокого проникновения 30 кв. м.
Обработка стен бетоноконтактом 50 кв.м.
Обработка откосов грунтовкой глубокого проникновения 30 пог.м.
Устройство штукатурной армировочной сетки 5х5 на стену 100 кв.м.
Устройство штукатурной армировочной сетки 5х5 на откосы 100 кв.м.
Установка маяков на стену 90 кв.м.
Штукатурка стен слоем до 3-х см 350 кв. м.
Штукатурка стен слоем от 3-х до 6-ти см 400 кв.м.
Штукатурка стен слоем от 6-ти см до 8 см 440 кв.м.
Штукатурка стен полукруглой формы 670 кв.м.
Штукатурка откосов арочных 800 пог.м.
Проклейка рустов и стыков плит серпянкой 50 пог.м.
ШУМОТЕПЛОИЗОЛЯЦИОННЫЕ И ГИДРОИЗОЛЯЦИОННЫЕ РАБОТЫ
Устройство шумоизоляции материалом типа «ЗИПС» на подготовленную поверхность 650 кв. м.
Устройство ленты типа Вибростек по периметру премыкания «ЗИПС» панелей 50 пог.м.
Монтаж звукопоглощающих плит типа Rockwool Акустик Баттс 350 кв.м.
Теплоизоляция стен пеноплексом 300 кв.м.
Демонтаж стен из гипса армированного 250 кв.м.
Демонтаж стен из гипса армированного 250 кв.м.
Демонтаж стен из гипса армированного 250 кв. м.
ПЛИТОЧНЫЕ РАБОТЫ
Затирка керамической плитки (однокомпонентная смесь) 100 кв.м.
Облицовка керамической настенной плиткой: одного рисунка, с «декорами» 800 кв.м.
Облицовка керамической плиткой размером 10*10 1200 кв.м.
Облицовка стен мозаикой 1400 кв.м.
Облицовка стен клинкерной плиткой или под камень (на подготовленную поверхность) 1300 кв. м.
Облицовка стен мрамором 2000 кв.м.
Облицовка откосов керамической плиткой 800 пог.м.
Облицовка арок угловой плиткой 1200 пог.м.
Установка бордюра 450 пог.м.
Запил торцов у керамической плитки (керамогранита) под 45 градусов 550 пог.м.
Затирка мозаики (однокомпонентная смесь) 300 кв. м.
Затирка клинкерной плитки или плитки под камень (однокомпонентная смесь) 300 кв.м.
Затирка керамической плитки двухкомпонентной затиркой 700 кв.м.
Затирка мозаичной плитки двухкомпонентной затиркой 1100 кв.м.
ОБЛИЦОВКА СТЕН ДЕКОРАТИВНЫМИ МАТЕРИАЛАМИ
Обшивка стен стеновыми панелями ПВХ 600 кв.м.
Облицовка стен вагонкой евростандарт 650 кв. м.
Покрытие вагонки лаком 2 раза с промежуточной шлифовкой 350 кв.м.
Укладка декоративного пробкового покрытия на стену 450 кв.м.
Монтаж гипсовых 3D панелей 2100 кв.м.
Монтаж мягких панелей 600 кв.м.
Монтаж ламината или паркетной доски на стены 680 кв.м.
Устройство декоративных изделий на стены
Устройство лепнины из твердого полиуретана 280 пог. м.
Устройство лепнины из твердого полиуретана под светильники 200 шт.
Устройство лепнины из гипса с обработкой стыков по прямой линии 400 пог.м.
Устройство лепнины из гипса с обработкой стыков по дизайнерскому лекалу 750 пог.м.
Устройство галтелей деревянных 180 пог.м.
Устройство галтлей пластиковых или из полиуретана (размер не более 4см х 4 см) 200 пог. м.
Покраска лепнины 200 пог.м.
МАЛЯРНЫЕ РАБОТЫ
ПОКЛЕЙКА ФОТООБОЕВ 700 кв.м.
ПОКРАСКА КЛИНКЕР.КИРПИЧА 650 кв.м.
Грунтовка стен после каждого слоя шпатлевки 30 кв.м.
Грунтовка откосов после каждого слоя шпатлевки 30 пог.м.
Устройство армировочной сетки 2х2 100 кв. м.
Устройство армировочной сетки 2х2 на откосы 100 пог.м.
Проклейка стен малярным стеклохолстом типа «паутинка» 120 кв.м.
Устройство защитного малярного уголка 90 пог.м.
Установка декоративных (защитных) уголков пластиковых 110 пог.м.
Базовый слой шпатлевки стен 150 кв.м.
Шпатлевка и шлифовка стен (подготовка под покраску) 460 кв. м.
Шпатлевка и шлифовка стен (подготовка под обои) 200 кв.м.
Шпатлевка и шлифовка стен полукруглой формы 580 кв.м.
Шпатлевка и шлифовка откосов шириной до 40 см 390 пог.м.
Поклейка стеклообоев под покраску 250 кв.м.
Поклейка обоев (флизелиновые или виниловые) 380 кв.м.
Поклейка текстильных обоев 480 кв. м.
Поклейка обоев в два уровня 600 кв.м.
Поклейка обойного бордюра 150 пог.м.
Нанесение жидких обоев 280 кв.м.
Обработка кирпичной кладки кислотой 180 кв.м.
Покрытие лаком декоративной кирпичной кладки 350 кв.м.
Покраска стен в/д краской валиком 220 кв. м.
Покраска откосов валиком 150 пог.м.
ПРОЧИЕ РАБОТЫ
Заделка штроб после прокладки кабеля 30 пог.м.
Заделка штроб после прокладки труб водопровода и канализации 40 пог.м.
Заделка штроб после прокладки трасс кондиционеров 40 пог.м.
Установка ревизионного люка под плитку 1200 шт.

Ремонт 2 двухкомнатной квартиры в Москве

Хотите сделать качественный и недорогой ремонт двухкомнатной квартиры в Москве? Это легко сделать с помощью строительной компании «БлагоДать». Мы предлагаем все виды ремонта двушки, от «эконома» и «комфорта» до дизайнерского эксклюзива «элит»-класса. Наша работа индивидуальна, что позволяет создать уникальное комфортное пространство для каждого жителя.

Особенности ремонта 2-комнатной квартиры под ключ

Заказав у нас услугу «ремонт двушки под ключ», Вы наверняка получите результат, превосходящий ожидания. И значительно сэкономите свое время, нервы и деньги, так как даже во время выполнения ремонтных работ, сможете жить обычной жизнью, а наши опытные строители решат все проблемы, включая покупку и доставку материалов на объект. В этом и заключается особенность ремонтных работ под ключ.

Этапы ремонта квартиры 2-комнатной от СК БлагоДать

  • Подробное изучение Ваших пожеланий по различным вопросам, включая необходимость перепланировки, дизайн, стиль, материалы и др.
  • Разработка дизайн-проекта в случае ремонта класса элит, который подразумевает оригинальные и стильные дизайнерские решения и эксклюзивные материалы. Поэтому стоимость ремонта 2-комнатной квартиры элит-класса самая высокая.
  • Черновые работы — освобождение квартиры от мебели и бытовой техники, демонтаж старых покрытий и коммуникаций, окон и дверей, а также черновое выравнивание и подготовка всех поверхностей.
  • Устройство электропроводки, систем отопления и водоснабжения, канализации, вентиляции и кондиционирования.
  • Монтаж тепловой, звуковой, гидро-изоляции. Цена ремонта двушки зависит во многом и от этих капитальных работ.
  • Чистовая отделка комнат с применением новых уникальных технологий.
  • Декорирование (чаще всего при элитном ремонте), подбор штор, встроенной мебели и аксессуаров.

Поэтому ответ на самый важный вопрос — «сколько стоит ремонт 2х комнатной квартиры», будет зависеть от перечня работ, их класса и от стоимости применяемых материалов.

Преимущества ремонта «двушки» с СК «БлагоДать»

Любой ремонт «двушки» — декоративный или капитальный — предусматривает материальную ответственность наших работников. При элитном ремонте квартир и домов каждый его этап контролируется руководством. Это гарантирует высокое качество ремонта и соблюдение сроков.


    К нашим преимуществам относятся:

  • уникальный дизайн;
  • применение высококачественных строительных материалов;
  • ценовые решения — на любой кошелек;
  • слаженная работа команды опытных строителей разных специальностей, успешно выполнивших сотни проектов;

Компания «БлагоДать» выполняет ремонт двушек в разных стилях: от классики до модерна. Мы делаем ремонт 2 комнатных квартир в новостройках, хрущевках, в старом фонде с отделкой, внимательно относимся ко всем пожеланиям клиента и всегда стремимся приятно удивить.

От чего зависит стоимость ремонта в 2-х комнатной квартире

Стоимость ремонта в 2-х комнатной квартире зависит от класса и типа ремонтных работ и лежит в пределах от до за 1 кв. м.

Узнать, сколько точно стоит ремонт Вашей двушки, можно у наших менеджеров. Пригласив специалиста к Вам домой, Вы сможете обсудить все нюансы предстоящих работ и получить на следующий день подробную смету.


Мы производим ремонт 2 комнатных квартир: 60 кв м, 52 кв м, 44 кв м (квадрата), 40 кв м

сколько примерно стоит (стоимость) сделать дешевую среднюю хорошую отделку 2 х комнатной квартиры в Санкт-Петербурге по смете

Отделка и ремонт двухкомнатной квартиры по недорогой стоимости под ключ от компании «Proremonting»

Нельзя сказать, что вопрос ремонта в наше время является острым. Большой ценовой ассортимент отделочных материалов и предложений по отделке и ремонту помещений любого плана, позволяет выбрать наиболее подходящий во всех отношениях вариант. За владельцем квартиры всегда остается право выполнить косметические работы самостоятельно. Обращаясь в нашу компанию и узнав, сколько примерно стоит отделка и ремонт двухкомнатной квартиры под ключ в СПб, наши клиенты навсегда отказываются от ремонта своими силами и заказывают качественное и быстрое проведение работ.

Большинство компаний, оказывающие услуги ремонта, часто представляют тарифы на свои работы завуалированно, предлагая предварительные выезды и так далее. Цена отделки и ремонта 2 х комнатной квартиры под ключ в нашей компании будет зависеть от размера вашего помещения и класса работ.

Узнать итоговую цену вы сможете на главной странице нашего сайта:

  • выберите в онлайн калькуляторе тип здания;
  • определитесь с характером ремонта: капитальный или косметический;
  • укажите метраж ремонтируемого помещения.

Всё! Узнав, во сколько обойдется средний ремонт 2 ух комнатной квартиры, можно оформлять заявку здесь же в форме онлайн или по контактным телефонам, связавшись с нашими представителями!

Сколько стоит сделать отделку и ремонт 2 х комнатной квартиры под ключ: бюджет, доступный для каждого

Мы располагаем готовыми вариантами, которые позволят вам не только прикинуть свои расходы, но и увидеть, за что вы будете платить вполне приемлемые деньги. Тем, кто не предпочитает экспериментировать, предлагаем воспользоваться готовыми проектами. Примеры полного типового ремонта 2 х ком квартиры со сметой всегда могут быть доработаны под индивидуальные предпочтения заказчика или его бюджет. При этом стоимость проекта не увеличивается.

Сколько будут стоить работы по ремонту и отделке в двухкомнатной квартире

Специально для вас мы подготовили информацию о наиболее часто встречающихся заказах на ремонт помещений. В зависимости от метража вашей квартиры будет рассчитываться стоимость заказа. Понятно, что хорошая отделка и ремонт 2 х комнатной квартиры по дешевой стоимости под ключ в помещении в 60 квадратных метров, стоит дороже, чем в квартире с метражом в 70 метров.

Преимущества заказа в специализированной компании

Оформление договора на оказание услуг с профессиональным подрядчиком избавит вас от негативных последствий низкооплачиваемой работы кустарных мастеров. Мы не помогаем советами по оформлению интерьера или выбору материалов. В основу качественного ремонта мы закладываем тщательный (и к тому же бесплатный) замер будущего фронта работы. На основании проведенных расчетов клиенту выдается полная смета предстоящих расходов с детальным обоснованием того, сколько в среднем нужно денег на ремонт и отделку двухкомнатной квартиры под ключ.

Имеющийся опыт работы, в том числе при отделке публичных мест, наши работники используют при исполнении любого заказа. Отделка и ремонт в квартире с двумя комнатами по недорогой стоимости под ключ будет ничуть не хуже, чем в готовом проекте, а может даже и превзойти его. Все будет зависеть от выбранных материалов, дополнительных корректив и класса отделки.

Ремонт 2 двухкомнатной квартиры под ключ в Москве

Владелец недвижимости, решивший обновить интерьер, должен понимать значимость стилевых решений, чтобы сменить надоевшую обстановку и стать обладателем уютного жилья.

Хороший ремонт двухкомнатной квартиры в Москве – это и лучшие материалы, продуманность деталей, четко составленный план действий, и соблюдение всех технологий. Самостоятельно добиться хорошего результата нелегко, лучше доверить работу профессионалам – наши специалисты с большим опытом на 100% знают, как преобразить квартиру.

Какой тип ремонта выбрать для 2х-комнатной квартиры?

В 2-комнатной квартире можно придерживаться одного стиля на всей площади, а можно добиться удачного сочетания диаметрально противоположных течений – такой интерьер гарантировано не наскучит. Выберите желаемый тип ремонта для «двушки»:

  • черновой – подойдет, если квартиру хотите продать без полной отделки;
  • косметический – бюджетный вариант, обновление видимых поверхностей;
  • капитальный – полная смена коммуникаций, нередко перепланировка, работы под ключ;
  • элитный – используются дорогие материалы и сложные технологии.

Если вы не можете определить, какой ремонт в квартире нужен, мы поможем – после осмотра и бесплатных замеров будет понятно, требуется ли капитальная отделка или будет достаточно освежить обои, напольное покрытие, потолок.

Отделка двушки – цена за 1 кв.м.

Стоимость ремонта в двушке рассчитывается при составлении сметы – заранее назвать точную сумму, которую придется заплатить, нельзя. Однако мы подготовили прайс-лист с расценками, можете примерно понять, каким будет бюджет, что подходит – экономный вариант, классика или элитная отделка.

Цены на ремонт «двушек» зависят от используемых материалов, вида работ, площади помещения. Мы выполняем работы в квартирах 40, 44, 49, 52, 60 кв.м., в «хрущевках», новостройках, домах, где отделка не проводилась длительный срок.

Как мы выполняем ремонт в квартире?

Без ложной скромности заявляем, что добротный ремонт 2х-комнатных квартир – наше призвание, работа, с которой справляемся на 5+ баллов из 5 возможных. Мы предлагаем:

  • сотрудничество без аванса;
  • профессиональных мастеров с опытом;
  • наличие в штате специалистов узкого профиля;
  • точные цены – не превышаем сметы;
  • замеры и консультации;
  • акции и подарки, в т. ч. составление дизайн-проекта;
  • длительную гарантию.

Репутация компании не позволяет работать халатно – делаем ремонт двух комнатных квартир на совесть, ищем  подход к клиентам, тщательно контролируем процесс и несем личную ответственность за каждого мастера в штате. Для нас важны хорошие отзывы, удовлетворенность заказчиков и тот факт, что в Москве станет на одно комфортное помещение больше.

Ремонт двухкомнатной квартиры в Казани | Делаем капитальный и косметический ремонт в новостройках и хрущевках | Цена от 2500 до 5500 Рублей за м2

Особенности ремонта двухкомнатной квартиры

Для владельцев двухкомнатной квартиры
неизбежно наступает момент, когда окружающий интерьер надоедает или начинает
разрушаться, и в голову постепенно закрадываться мысль о ремонте. Но, помня
народную мудрость, что ремонт нельзя закончить, а можно только приостановить,
разумный человек начинает взвешивать свои потребности и возможности. Принять
решение и начать ремонт – это серьезный шаг, который нельзя предпринимать в
суете и спешке. Необходимо взвешенно обдумать делать ли его самим или
обратиться за помощью к профессионалам? Давайте поразмышляем вместе, ведь одна
голова – хорошо, а две – всегда лучше!

Ремонт 2-комнатной квартиры – задача непростая, ведь нужно на маленьком пространстве разместить все необходимое для комфортной жизни.

Порядок проведения ремонта двухкомнатной квартиры:

Есть 2 принципиальных момента, которые сказываются на дальнейшем регламенте проведения и стоимости ремонта Вашей квартиры: во-первых, требуется ли перепланировка и демонтаж старой отделки(новостройка или хрущевка?), а во-вторых нужна ли предварительная разработка дизайн-проекта.

  • После того, как вы определились, нужна ли Вам разработка дизайн проекта или вы сами четко представляете, что хотите – бесплатно вызовите нашего прораба на объект
  • Во время выезда, прораб производит необходимые замеры, а также выясняет у вас все детали предстоящего ремонта. Если вы решили, что нужно разработать дизайн-проект, прораб также привезет портфолио нескольких дизайнеров — у вас будет возможность самостоятельно выбрать того, кто будет непосредственно заниматься отрисовкой Вашего помещения.
  • Далее в течение 2-х рабочих дней мы высылаем Вам смету с комментариями прораба, которая включает в себя: смету на разработку дизайн-проекта(если это необходимо), смету на работы, смету на строительные материалы, график работ.
  • После согласования сметы и графика работ, мы подписываем Договор и назначаем на ваш проект опытного прораба, со стажем работы минимум 10 лет, который непосредственно будет осуществлять управление Вашим проектом.
  • Если выбран вариант ремонта с разработкой дизайн проекта, то сначала мы разрабатываем и согласуем с Вами дизайн проект и после этого уточняем сметы на работы и материалы.
  • Далее проводятся непосредственно выполнение всех необходимых работ по конвейерному принципу, все под ежедневным контролем прораба! Во время выполнения проекта также с нашей стороны проводится технический надзор отдельным специалистом.
  • Сдаем проект «под ключ», выдаем гарантийный сертификат на срок от 3-х лет!

Этот перечень отлично подойдет и для ремонта 3-комнатной квартиры. Например, если вам не нужен демонтаж перегородок, мы его не выполняем.
Приведенный выше список является приблизительным, так как в каждом случае
ремонт двухкомнатной квартиры производится в индивидуальном порядке. Набор
работ и очередность их выполнения вы узнаете у специалиста, являющегося
ответственным за ваш ремонт.

Порядок цен на ремонт квартир больщей площади, к примеру, на ремонт 4-комнатной квартиры или ремонт 5-комнатной квартиры вы так же можете узнать из примеров смет, представленных на сайте.

Особенности ремонта 2-комнатных квартир в новостройках и хрущевках

Ремонт в новостройке

Ремонт в хрущевке

  • Не требуется демонтаж старой отделки
  • Если квартира сдана в черновой отделке – требуется большой блок подготовительных работ – прокладка проводки, стяжка, штукатурка и выравнивание стен
  • Помните про усадку нового дома! Ремонт следует начинать через 1,5 года после сдачи.
  • Легко сделать перепланировку – несущих стен в новых домах все меньше
  • Капитальные стены осложняют перепланировку
  • Демонтаж старой отделки = дополнительная головная боль
  • Шумные работы необходимо проводить строго до 18:00 – чтобы соседи не жаловались
  • Обычно требуется замена стояков и других сантехнических коммуникаций

Ремонтно-отделочные работы в Казани лучше всего осуществят специалисты компании Ремонт-16. Уже многие годы мы проводим все виды отделочных работ, строительно-монтажных и инженерных работ, а также помогаем своим клиентам определиться с дизайном объекта!

Нашим несомненным плюсом является высокий уровень знаний и опыт наших специалистов – даже самые необычные и оригинальные дизайнерские решения будут с легкостью выполнены нашими мастерами под чутким контролем опытных прорабов! Ремонт – это та сфера, где Ремонт-16 занимает лидирующие позиции на казанском рынке уже не первый год.

Доверив свой объект нашим специалистам, Вы можете ни о чем не волноваться, все тяготы процесса стройки мы возьмем на себя. Вам останется лишь в конце с легким сердцем подписать акт приемки-сдачи и начать эксплуатацию объекта.

Ремонт Xiaomi Mi Mix 2 Архангельск от 790 руб.

Точную причину неисправности в смартфонах наши специалисты выяснят сразу. Помогает в этом полная диагностика гаджета. Предварительное обследование определяет какой требуется ремонт Xiaomi Mi Mix 2. То есть способствует правильному выбору варианта устранения неполадки.

Мы вернём Вашему мобильному аппарату рабочее состояние при любых обстоятельствах. Потому что проводим все восстановительные операции с применением профессиональных приборов и оригинальных запчастей. Такие средства у нас во всех 314 структурных подразделениях, находящихся в 122 городах страны.

Разумные цены на ремонт Ксиаоми Ми Микс 2 в сервисах Pedant

Наши опытные мастера устраняют любой дефект в оперативном порядке. Наряду со скоростью решения задачи, мы предлагаем своим пользователям эффективный ремонт Ксиаоми Mi Mix 2 в Архангельске по минимальной стоимости. Независимо от вида работы:

  • замену аккумулятора или камеры;
  • обновление стекла или дисплея;
  • зачистку повреждений утопленного девайса.

На восстановленный телефон действует гарантия сроком до трёх месяцев.

Услуга Цены
Замена экрана от 4 690 р.
Замена аккумулятора от 2 490 р.
Замена задней крышки от 3 190 р.
Бронирование/Обтяжка гидрогелевой пленкой от 790 р.
Замена микросхемы от 3 490 р.
Замена элемента от 2 290 р.
Замена разъема SIM от 1 890 р.
Замена вибромотора от 1 890 р.
Замена голосового динамика от 1 690 р.
Замена кнопок громкости от 2 390 р.
Замена основной камеры от 1 990 р.
Замена микрофона от 1 790 р.
Замена полифонического динамика от 1 690 р.
Замена кнопки включения от 2 590 р.
Замена передней камеры от 1 890 р.
Обновление ПО от 1 090 р.
Программный ремонт/перепрошивка от 1 090 р.
Снятие пароля от 1 090 р.
Сбор/Разбор от 1 490 р.

Макрофаги непосредственно вносят коллаген в образование рубцов во время регенерации сердца рыбок данио и восстановления сердца мышей

Содержание животных и их штаммы

Это исследование было проведено в соответствии с процедурами, утвержденными Министерством внутренних дел Великобритании в соответствии с законодательством Великобритании (Закон о научных процедурах животных 1986 г. ) и одобрены Комитетом по этике исследований Оксфордского университета.

Дикий тип, TgBAC (mpeg1: BirA-Citrine) ox122 20 , Tg (βactin: Avi-Cerulean-RanGap) ct700AC9000 198 : 900B BirA-цитрин; β актин: Avi-Cerulean-Rangap) ox133 20 , Gt (foxd3-Citrine) ct110 40 , TGP1 gl22 38 и Tg (mpeg1: mCherry) gl23 38 рыбок данио разводили и содержали в соответствии с установленными протоколами 55 .

Мышей CD1 дикого типа (Harlan), Col1a2-CreERT2, Col1a1-GFP, R26R-tdTomato, R26R-YFP, hCD68-GFP и GFP. Оксфорд, Великобритания. Там, где указано, детенышам от вязок самец Col1a2-CreERT2 x самка R26R-YFP инъецировали на 5 день после ИМ 50 мкл 10 мг / мл тамоксифена (общая доза 0,5 мг), растворенного в арахисовом масле. Щенков собирали в указанный момент времени и генотипировали по Cre и YFP.

Модели повреждений сердца

Повреждения сердца были выполнены у рыбок данио в возрасте 4–12 месяцев 6,7,8 . Вкратце, криоповреждение выполняли путем наложения замороженного жидким азотом криозонда на поверхность обнаженного желудочка до полного оттаивания зонда, повреждая примерно 20% желудочка. Для резекции желудочка хирургическим путем удалили 20% верхушки желудочка, что привело к немедленному образованию тромба. Открытие желудочка без травм выполняли для фиктивного контроля.

Была выполнена постоянная перевязка левой передней нисходящей коронарной артерии для индукции ИМ у взрослых мышей. 56 .При неонатальном инфаркте миокарда мышей анестезировали изофлураном 2%, а затем охлаждали на льду, чтобы вызвать остановку сердечно-дыхательной системы 57 . Затем была выполнена боковая торакотомия, и затем вокруг левой передней нисходящей коронарной артерии наложили проленовую нить 7-0 (Ethicon), чтобы вызвать инфаркт миокарда. Грудь и кожу закрывали проленом 7-0, и детенышей повторно нагревали под нагревательной лампой перед возвращением матери.

Общая экстракция РНК и анализ экспрессии гена Nanostring nCounter

Целые сердца рыбок данио, включая предсердие, артериальную луковицу и желудочек, собирали и хранили в стабилизирующем растворе RNAlater (Thermo Fisher Scientific) при -80 ° C. Образцы собирали в трех экземплярах. Свежезамороженные сердца механически диссоциировали в буфере для лизиса с использованием ручного пестика для гранул (Sigma-Aldrich). Затем экстракцию РНК проводили с использованием набора Purelink RNA Mini (Thermo Fisher Scientific). Обработку ДНКазой проводили на образцах с использованием набора TURBO DNA-free Kit (Thermo Fisher Scientific). Чистоту и концентрацию РНК оценивали с помощью NanoDrop 2000 (Thermo Fisher Scientific). Анализ экспрессии гена nCounter (NanoString Technologies, Сиэтл, Вашингтон) выполняли, как описано ранее 58 , с использованием 150 нг общей РНК на сердце.Наборы кодов экспрессии генов (разработанные и произведенные NanoString Technologies, Сиэтл, Вашингтон), буфер для гибридизации и суммарная РНК гибридизовали в термоциклере в течение 18 ч при 65 ° C перед обработкой в ​​nCounter Prep Station. Сбор данных с помощью цифрового анализатора производился с настройкой максимального поля зрения. Графики были созданы с использованием пакета R. Количество сырых зондовых мРНК было нормализовано до β-актина, чтобы компенсировать различия в размере сердца. Статистическая значимость рассчитывалась с помощью двустороннего непарного критерия Стьюдента t ; * p <0.05.

Количественная ПЦР в реальном времени

Суммарную РНК выделяли из сердец мышей с использованием набора Qiagen RNeasy Mini Kit (Qiagen). Комплементарную ДНК синтезировали с использованием системы обратной транскрипции (Promega), следуя инструкциям производителя, и использовали для количественной ПЦР в реальном времени с использованием SYBR Green на ABI 7900 для следующих генов: Col1a2, Col1a2, Col1a3 . Изменение складки определяли с применением метода 2 — ΔΔCt . Были использованы следующие последовательности праймеров: COL1A1 FWD-GCAAGAGGCGAGAGAGGTTT, REV-GACCACGGGCACCATCTTTA, Col1a2 FWD-CTGGAACAAATGGGCTCACTG, REV-CAGGCTCACCAACAAGTCCTC, COL3A1 FWD-ACGTAGATGAATTGGGATGCAG, REV-GGGTTGGGGCAGTCTAG.

Cas9-only и col4a3bpa / col4a1 CRISPR / Cas9-целевые макрофаги рыбок данио были отсортированы с помощью FAC, а экстракция РНК и синтез кДНК были выполнены с использованием набора RNA Water ® -Micro Kit (Life Technologies) и обратной транскриптазы Superscript III. (Invitrogen) соответственно. Количественную ПЦР проводили с использованием Fast SYBR Green Master Mix (Applied Biosystems) в системе для ПЦР в реальном времени StepOnePlus (Thermo Fisher Scientific). Ген-специфические праймеры, используемые для col4a1 , были FWD1-CAAAGGAACTGATGGGCAAC; REV1-AGCTCCTTTTGTAACATCACATTC; FWD2-TCAGGTTTTCAAGGAGAGCC; REV2-TTTGGGACCTGGAAAAGACC; FWD3-ACTTCAAGAACACATTTGCGTC; REV3-GATGGAACTGCCTTAGTTAACAC.Ген-специфические праймеры, используемые для col4a3bpa , были FWD1-GTGGACAAACTACATTCATGGC; REV1-GCCGTACTCCTTCTCATCTG; FWD2-CGGCAAACTCAGTAAGTGGAC; REV2-TGAGAATATTGCCCTTCAGCG; FWD3-AGAAGGAGTACGGCTGTAGAG; REV3-AGATGCTGTCGTTCACACTG. Уровни экспрессии были нормализованы по β-актину, и кратность изменения была определена с применением метода 2 -ΔΔCt .

Выделение ядер с биометками у рыбок данио

Ядра с биотегами выделяли, как описано ранее 19 . Вкратце, TgBAC (mpeg1: BirA-цитрин; β актин: Avi-Cerulean-Rangap) ox133 оперированных взрослых сердец ( n = 1 на образец) промывали и инкубировали на льду в гипотоническом буфере H. (20 мМ HEPES, pH 7.9; 15 мМ MgCl 2 ; 10 мМ KCl; 1 мМ DTT; 1 X Полный ингибитор протеазы) на 30 мин. Образцы сердца переносили в гомогенизатор Dounce (2 мл Kontes Glass Co, Vineland, NJ), диссоциировали 10 взмахами свободно прилегающего пестика А и инкубировали на льду в течение 5 мин. Дальнейшую диссоциацию проводили 10 ударами плотно прилегающего пестика B каждые 5 мин в течение 15 мин. Ядра собирали центрифугированием (2000 × г, , 4 ° C) и ресуспендировали в 1 мл буфера для нейтрализации ядер NPB (10 мМ HEPES, pH 7.9; 40 мМ NaCl; 90 мМ KCl; 0,5 мМ ЭДТА; 0,5 мМ спермидин; 0,15 мМ спермина; 1 мМ дитиотреитол и 1 X полный ингибитор протеазы). Для очистки ядер ядра инкубировали с 250 мкг покрытых стрептавидином бусинок M-280 (Invitrogen) с вращением в течение 30 мин при 4 ° C. Система на основе потока была использована для захвата ядер, связанных на гранулах стрептавидина. Сериологическая пипетка на 10 мл (VWR), прикрепленная к наконечнику микропипетки на 1 мл (наконечник для пипетки Rainin), обе предварительно обработанные NPB + 1% BSA) в течение 30 минут, добавляли к магнитному сепаратору MiniMACS (OctoMACS Separator, Miltenyl Biotec). ).Двухходовой кран (Biorad) подсоединяли к концу наконечника микропипетки на 1 мл через кусок трубки Tygon (Fisher Scientific), и скорость потока устанавливали на ~ 0,75 мл / мин. Суспензию гранул ядер разбавляли добавлением 9 мл NPBt (NPB с 0,01% Triton X-100) и добавляли в установку с медленным потоком. Затем наконечник снимали с подставки, и ядра-шарики высвобождали из наконечника путем медленного пипетирования 1 мл NPBt в наконечник и из наконечника. Затем раствор снова разбавляли до 10 мл с помощью NPBt и снова добавляли в установку с медленным потоком. Ядра-гранулы элюировали 1 мл NPBt, как описано выше, и NPBt удаляли с использованием магнитной подставки (магнит DynaMag TM-2, Invitrogen). Затем ядра-бусины обрабатывали для экстракции РНК.

Проточная цитометрия и стробирование мышей

Суспензии одноклеточной ткани сердца получали путем измельчения сердца и осторожного встряхивания в коллагеназе 500 единиц на мл в растворе HBSS в течение 1 часа при 37 ° C. Образцы пропускали через фильтр с размером пор 70 мкм, промывали и ресуспендировали в 1% FBS / PBS. Образцы инкубировали с FcR-блоком, а затем метили анти-CD45 (Biolegend 103124, 1: 200), анти-CD11b (Biolegend 101206, 1: 100), анти-Ly6G (Biolegend 127636, 1: 200), анти- F4 / 80 (Biolegend 123110, 1: 100), анти-Ly6C (Biolegend 128026 1: 800), анти-CD206 (Biolegend 141721, 1: 100).Где указано, макрофаги были отсортированы на FACSAriaIII. Популяции клеток регистрировали, как показано на дополнительном рисунке 2. Вкратце, дублеты исключались (FSC-W по сравнению с FSC-A) и мертвые клетки удалялись с помощью 7-AAD. Миелоидные клетки были заблокированы для CD45 + , CD11b + и нейтрофилов, идентифицированных по положительности для Ly6G. Макрофаги были идентифицированы как клетки Ly6G F4 / 80 + . Моноциты были идентифицированы как клетки Ly6G F4 / 80 + LyC hi / lo . Анализ проводился с помощью FlowJo v10.0.8.

Экстракция РНК и подготовка библиотеки

Экстракцию тотальной ядерной РНК у рыбок данио и обработку ДНКазой проводили с использованием набора RNA Water Micro Kit (Life Technologies) в соответствии с инструкциями производителя. Целостность РНК проверяли с помощью пикочипа РНК (Agilent Technologies), используя Agilent 2100 Bioanalyzer. кДНК синтезировали и амплифицировали из 100–300 мкг входной РНК с использованием набора SMART-seq TM v4 Ultra Low входной РНК (Clontech Laboratories). Библиотеки секвенирования получали с использованием набора для подготовки библиотеки ДНК Nextera XT.

Мышиную РНК экстрагировали из FAC-отсортированных макрофагов с использованием набора для выделения RNA Water®-Micro Total RNA от Life Technologies (Ambion). кДНК получали с использованием набора Clontech SMART-Seq v4 Ultra Low Input RNA и библиотек, созданных с помощью набора для подготовки образцов ДНК Nextera XT, в соответствии с инструкциями производителей. Количественную оценку библиотек проводили с использованием Agilent Bioanalyzer с набором для анализа высокочувствительной ДНК, объединяли и запускали на приборе Nextseq 2500.

Анализ RNA-seq

Секвенирование следующего поколения выполняли на платформе NextSeq500 с использованием 150-циклового набора NextSeqTM500 High Output Kit) ( Illumina) для создания парных конечных чтений из 80 пар оснований.Качество чтения оценивалось с помощью FastQC 59 . Считывания рыбок данио были сопоставлены с версией сборки Zv10 / danRer10 от июля 2014 г. генома рыбок данио с использованием выравнивателя с поддержкой сплайсинга STAR (v.2.4.2a) 60 . Таблицы счетчиков были созданы с использованием подпотока FeatureCounts (v1.4.5-p1q) со стандартными параметрами 61 . Дифференциальное выражение было выполнено с использованием пакета DESeq2 R 62 . Необработанные и обработанные данные, полученные в этом исследовании, были отправлены в GEO (инвентарный номер GSE100029), выходные данные дифференциального выражения доступны в виде файла дополнительных данных 1.Иерархическая кластеризация была проведена на генах, значительно дифференциально экспрессируемых по крайней мере в одном сравнении ( p -значение <0,05). Сравнения, в которых значения p отсутствовали, были исключены. log 2 Значения изменения сгиба из анализа DESeq2 были использованы для расчета евклидовых расстояний, а метод минимальной дисперсии Уорда (Ward D) был использован для выполнения иерархической кластеризации (k = 9). Для мыши обрезанные чтения (Trim Galore v.0.3.7, http: //www.bioinformatics.babraham.ac.uk/projects/trim_galore, с настройками по умолчанию) были проверены на качество (FastQC v.011.3, http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc), а затем сопоставлены с геномом мыши (Mm10) с использованием TopHat 63 v2. 1.10, с Bowtie 64 v.2.2.6, с использованием настройки «чувствительность к b2» с внутренним расстоянием сопряжения = 208 и стандартным отклонением сопряжения = 213, определенным из тестовых выравниваний. Аннотации транскриптомов, загруженные с веб-сайта Illumina iGenomes (UCSC Mm10, https://support.illumina.com / Sequencing / Sequencing_software / igenome.html) использовались с запонками для сопоставления транскриптов. Cuffdiff использовался для попарных сравнений. Гены с log 2 -кратным изменением> 2 и FDR <0,05 считались значительно дифференциально экспрессируемыми. Результаты Cuffdiff были загружены в R (http://www.R-project.org) для дальнейшего анализа и построения графиков, включая анализ основных компонентов (PCA) с использованием пакета pcaMethods 65 и создание тепловой карты с помощью pheatmap (http: // CRAN .R-project.org/package=pheatmap). Для временного анализа были получены необработанные подсчеты из Cuffdiff, а гены с <5 отсчетами во всех образцах были удалены перед проведением тестов. DESeq2 62 использовался для идентификации генов, демонстрирующих дифференциальную временную регуляцию, а STEM v.1.3.8 66 использовался для временной кластеризации и анализа обогащения генной онтологии временных профилей. Необработанные и обработанные данные, полученные в этом исследовании, были отправлены в GEO (инвентарный номер GSE126772), а выходные данные дифференциального выражения доступны в виде файла дополнительных данных 2.Пользовательский сценарий R (файл дополнительных данных 3) был использован для создания графика значимости перекрытия кластеров на дополнительном рисунке 5.

sgRNA, синтез мРНК Cas9 и инъекции

ДНК-матрица sgRNA

была создана с уникальным олигонуклеотидом, кодирующим РНК-полимеразу T7. сайт узнавания, последовательность-мишень sgRNA и перекрытие с tracrRNA. Полный список ген-специфических олигонуклеотидов доступен в дополнительной таблице 3. Каждый ген-специфичный олигонуклеотид sgRNA сначала был отожжен с универсальной обратной олигонуклеотидной последовательностью tracrRNA (AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTCAAGTTGATAACGGACTAGCCTAATTATTTC0189 GCTTC0189 и затем амплифицирован GCTACR). Транскрипцию in vitro проводили с использованием очищенной ДНК-матрицы 500–1000 нг для использования набора для РНК-полимеразы Т7 (NEB) в течение 4 ч при 37 ° C и sgRNA, очищенной с помощью набора Megaclear (Ambion).

мРНК Cas9 транскрибировали in vitro из плазмиды MLM3613 (Addgene, каталожный номер 42251) с использованием набора mMESSAGE mMACHINE T7 (Ambion). sgRNA (20 пг / нл) и мРНК cas9 (90 пг / нл) вводили на стадии одной клетки.

Анализ HRMA

Геномную ДНК экстрагировали из отдельных эмбрионов через 24 часа после оплодотворения с использованием мини-набора Purelink Genomic DNA (Invitrogen).Праймеры были разработаны для создания продукта размером ~ 200 п.н., охватывающего участок разреза, дополнительная таблица 4. Мастермикс Hotshot Diamond PCR (Client Lifescience) использовали для проведения ПЦР с красителем LC Green Plus (BioFire Diagnostics). Цикл реакционных растворов проводили на термоциклере C1000 Touch TM Bio-Rad.

Секвенирование следующего поколения для проверки событий редактирования генома

Ген-специфические праймеры с адаптерами illumina i5 и i7 были разработаны для амплификации предсказанного сайта расщепления Cas9, генерирующего ампликон размером ~ 120 п. н.Во втором раунде амплификации библиотеки были созданы и проиндексированы с использованием набора Nextera XT Index (Illumina). Библиотеки количественно оценивали с помощью набора Qubit ds DNA HS Assay (Thermo Fisher Scientific, Q32854), а размер проверяли с помощью Tapestation D1000 (Agilent). Библиотеки секвенировали с помощью набора реагентов MiSeq 300 циклов (Illumina).

Эмбриональное «трио» мечения эндогенных белков коллагена

Мы объединили редактирование генома на основе гомологически независимой репарации с захватом белков на основе интронов («трио» мечения), чтобы эндогенно пометить col4a1 в эмбрионе рыбок данио.Интроны были выбраны на основе областей белка, в которых вставка метки не нарушала бы полимеризацию коллагена, его экспорт во внеклеточный матрикс или образование функциональных фибрилл 67,68 . Успешно помеченный интрон фланкирован экзонами 23 и 24. 1 нл инъекционного раствора, содержащего две sgRNAs, нацеленные на донорный вектор в области, несущей экзон цитрина, фланкированный акцепторными и донорными сайтами сплайсинга 69 , и одна sgRNA, нацеленная на интронную область интересующий ген (каждый по 12. 5 нг / мкл), донорская конструкция (25 нг / мкл; полная последовательность вектора FlipTrap доступна через номер доступа NCBI JN564735 69 ), белок Cas9 (100 нг / мкл; PNA Bio Inc) и 10% фенол- красный (5 мг / мл в 150 мМ KCl; Sigma-Aldrich) вводили в Tg (mpeg1: mCherry) gl23 эмбрионов на стадии 1 клетки. Для последовательностей sgRNA, пожалуйста, проверьте дополнительную таблицу 3. Для праймеров HRMA, пожалуйста, проверьте дополнительную таблицу 4. Все компоненты «трио» мечения были предварительно собраны за 24 часа до инъекции и хранились при -20 ° C, как это было показано. повысить эффективность интеграции донорского вектора.После CRISPR / Cas9-опосредованного нокаута линеаризованного донорского фрагмента в целевой интрон col4a1 in vivo была сгенерирована гибридная мРНК Citrine , фланкированная экзонами 23 и 24 из col4a1 , аналогично подходу недавно опубликовано in vitro 70 . За эмбрионами наблюдали, оценивали их флуоресценцию и собирали для FACS при 6 dpf. Макрофаги mCherry + были отсортированы и использованы для экспериментов по адаптивному переносу. Приблизительно 30-40% инъецированных эмбрионов показали мозаичное мечение интересующего белка.Домен экспрессии слитого с цитрином белка фенокопировал описанный паттерн экспрессии, депонированный в базе данных Zfin (https://zfin.org). Для эффективного мечения эндогенного белка должны присутствовать все компоненты раствора для мечения «трио». Экспрессия коллаген-цитрин не наблюдалась, когда sgRNA, нацеленная на интрон, не включалась в предварительно собранный раствор для инъекций.

Сортировка клеток с активацией флуоресценции (FACS) и исследования адаптивного переноса клеток

Макрофаги GFP рыбок данио + были выделены из Tg (mpeg1: EGFP) gl22 оперированных взрослых сердец или целых эмбрионов с помощью FACS.Макрофаги mCherry + были выделены из Tg (mpeg1: mCherry) gl23 с помощью FACS. Клетки нервного гребня, используемые в качестве контроля в экспериментах по переносу адоптивных клеток, были выделены из 16-сомитов стадии Gt (foxd3-citrine) ct110 эмбрионов. Перед FACS ткань диссоциировали с использованием 20 мг / мл коллагеназы в буфере 0,05% трипсина / 0,53 мМ EDTA / 1xHBSS для получения суспензий отдельных клеток. Реакцию останавливали в 10 мМ HEPES / 0.Сортировали 25% буфер BSA / 1xHBSS и клетки GFP + и / или mCherry + (FACSAria, BD Biosciences Fusion System). Отсортированные клетки центрифугировали на низкой скорости, ресуспендировали в 5 мкл буфера Хенкса и немедленно использовали для трансплантации. Адаптивный перенос макрофагов (примерно 3000 клеток, если получены от взрослых особей; 20 000–30 000 клеток, если получены от эмбрионов) животным-реципиентам проводили с помощью ретроорбитальной инъекции 39 5 мкл суспензии клеток или буфера Хенкса. Через 6, 13 и 20 дней после трансплантации рыбок данио умерщвляли и собирали сердца.

Моноциты мыши выделяли из селезенки взрослых мышей CD68-GFP + и GFP tpz -коллаген. После умерщвления по схеме 1 селезенку удаляли путем рассечения и разрыв ткани тупым концом стерильного шприца. Разрушенную ткань селезенки промывали через клеточный фильтр 70 мкм буфером для лизиса эритроцитов и инкубировали при комнатной температуре в течение 10 мин. Затем клетки центрифугировали (400 × г в течение 5 мин) и буфер для лизиса эритроцитов удаляли путем аспирации.Затем моноциты очищали от клеточного осадка с использованием набора для обогащения мышиных моноцитов EasySep TM Mouse Monocyte Enrichment Kit в соответствии с инструкциями производителя. Перед операцией, то есть перманентной перевязкой ПМЖВ, клетки подсчитывали и ресуспендировали в стерильном PBS. В экспериментах по адаптивному переносу новорожденных каждое животное-реципиент (постнатальный день 1; P1) получало 50000 клеток путем внутримиокардиальной инъекции (с использованием инсулинового шприца 30G) во время лигирования LAD, тогда как для экспериментов по адаптивному переносу взрослых животных каждое животное-реципиент получало 100000 внутримиокардиальная инъекция клеток (с помощью инсулинового шприца 30G) во время операции по поводу инфаркта миокарда.

Выделение сердечных клеток

После инфаркта миокарда сердца мышей собирали для исследований проточной цитометрии на 7 день после травмы; отдельные сердца выделяли, помещали в холодный HBSS (Life Technologies), мелко измельчали ​​на мелкие кусочки и расщепляли раствором коллагеназы типа II (Worthington Laboratories) (содержащим 500 единиц / мл HBSS) при 37 ° C в течение 30 минут при перемешивании. Супернатант удаляли и добавляли 10% инактивированный нагреванием FBS (Sigma). Оставшуюся ткань переваривали свежим раствором коллагеназы всего 3 раза.Суспензии клеток объединяли и фильтровали через сетчатый фильтр для клеток 40 мкм (BD Falcon). Клетки центрифугировали, промывали PBS и буфером для лизиса красных клеток (BioLegend), используемым в соответствии с инструкциями производителя для удаления красных кровяных телец. Изолированные отдельные сердечные клетки окрашивали и подвергали анализу проточной цитометрией.

Проточная цитометрия клеток GFP + в инфаркте сердца

Для исследований проточной цитометрии Col1a1-GFP трансгенных мышей 37 , которые подверглись лигированию LAD, собирали и обрабатывали, как описано выше. Выделенные клетки ресуспендировали в 2% растворе FBS / PBS и блокировали инкубацией в FcBlock на льду. Популяцию макрофагов идентифицировали путем иммуноокрашивания в течение 20 минут при комнатной температуре с использованием антитела F4 / 80-PE (BioLegend Inc., каталожный номер 123110, разведение 1: 100). Для окрашивания фибробластов на обработанных образцах сердца изолированные клетки окрашивали анти-Feeder Cells-APC (клон Miltenyl Biotec mEF-SK4, 1:20). Краситель с высокой флуоресценцией 7-аминоактиномицин D (7AAD) был добавлен перед клеточными анализами для определения жизнеспособности клеток и исключения мертвых клеток.Проточный цитометрический анализ выполняли с использованием проточного цитометра BDFACSAriaIII (BD Biosciences) и программного обеспечения FlowJo.

Выделение и культивирование макрофагов костного мозга (BMDM)

Клетки костного мозга были выделены из бедренных и большеберцовых костей 3–5-месячных трансгенных мышей GFP tpz -коллаген. Клетки высевали на 100-миллиметровые чашки Петри, обработанные нетканевой культурой (Thermo Fisher, UK), и поддерживали в среде для дифференцировки макрофагов (DMEM с добавлением 10% инактивированной нагреванием фетальной телячьей сыворотки (FBS), 2 мМ L-глутамина, 2% пенициллина. / стрептомицин и 20% супернатант от клеток L929 как источник макрофагального колониестимулирующего фактора).На 7 день после выделения BMDM были положительно отобраны трипсинизацией и последующим вымыванием неприлипающих клеток. После положительного отбора BMDM поддерживали в среде для выращивания макрофагов (DMEM с добавлением 10% FBS, 2 мМ L-глутамина и 2% пенициллина / стрептомицина) в течение 1-2 дней перед тем, как поместить на чашки для визуализации.

Стимуляция отложения GFP-коллагена

GFP tpz -коллаген BMDM засевали на покрытые матригелем покровные стекла с плотностью клеток 3 × 10 4 клеток / см 2 вместе с мышиными клетками L929 (1.5 × 10 4 клеток / см 2 , получено из Американской коллекции типовых культур). Для стимуляции отложения коллагена в среду для выращивания (DMEM с 10% FBS, 2 мМ L-глутамина и 2% пенициллина / стрептомицина) добавляли комбинацию супернатантов (SNT) от стимулированных фибробластов L929 и первичных эндотелиальных клеток микрососудов сердца мыши. MCEC (C57-6024, полученный от Cell Biologics) в соотношении 2: 1: 1 (среда для выращивания: L929 SNT: MCEC SNT) в течение 6-9 дней. Для облегчения отложения коллагена ежедневно добавляли 50 мкг / мл свежей аскорбиновой кислоты (A92902, Sigma-Aldrich), а среду с добавлением SNT меняли каждые 2 дня.Для приготовления супернатантов монокультуры L929 и MCEC выращивали до слияния в среде DMEM с добавлением 10% FBS, 2 мМ L-глутамина и 2% пенициллина / стрептомицина. В среду клеток L929 добавляли 10 нг / мл TNFα (410-MT / CF, R&D Systems), 10 нг / мл IL-1β (401-ML / CF, R&D Systems), 10 нг / мл IL-4 (404- ML / CF, R&D Systems) и 10 нг / мл TGFβ (7666-MB / CF, R&D Systems). В среду MCEC добавляли 10 нг / мл TNFα (410-MT / CF, R&D Systems). После 48 ч инкубации супернатанты обеих монокультур собирали, центрифугировали для удаления остатков клеток и хранили при -20 ° C до использования.

Иммунофлуоресценция совместных культур BMDM-фибробластов

Культуры стимулировали L929 SNT в соотношении 1: 1 со средой для выращивания. L929 SNT был получен из конфлюэнта L929, стимулированного 10 нг / мл TNFα и 10 нг / мл IL-1β в течение 6 дней. Клетки фиксировали в 4% параформальдегиде, но стадию пермеабилизации не проводили, чтобы сохранить внеклеточную структуру коллагена. Клетки инкубировали с бессывороточным раствором белкового блока (X0909, Dako) в течение 1 ч при комнатной температуре и с первичными антителами в течение ночи при 4 ° C.Используемые антитела были анти-CD68 (Abcam) 1: 250, анти-GFP (Abcam) 1: 500 и анти-Col1a (Abcam) 1: 200. Клетки помещали в монтажную среду ProLong ™ Diamond с DAPI (Thermo Fisher). Изображения были получены с помощью конфокального микроскопа Leica DM600 CFS.

Количественная оценка коллагеновых волокон

Для количественной оценки отложения коллагена изображения были проанализированы с использованием подключаемого модуля ImageJ NeuronJ 71 . Вкратце, изображения были разделены на 4 квадранта, и длина коллагеновых волокон GFP t pz + была измерена в каждом квадранте с использованием инструмента отслеживания NeuronJ. Общую длину коллагеновых волокон на квадранты, содержащие 0 или 1 макрофаг, наносили на график в зависимости от длины коллагеновых волокон, измеренной в квадрантах, содержащих более одного макрофага. Связь между длиной коллагеновых волокон и содержанием макрофагов проверяли с помощью двустороннего непарного теста Стьюдента t . Значения считались значимыми при * p <0,05.

Иммунофлуоресценция, HCR in situ и визуализация

Для иммуноокрашивания срезов фиксированные сердца рыбок данио помещали в ОКТ, делали криосрезы и окрашивали 8 .Вкратце, неспецифические сайты связывания насыщали путем инкубации в течение 1 ч в блокирующем растворе (5% козья сыворотка, 0,3% Твин-20). В качестве первичных используемых антител были антитела против mpeg1 (1: 200, GeneTex), против тяжелой цепи миозина MF20 (1: 200, DSHB), против mCherry (1: 200, Clontech; 1: 150, GeneTex), против коллагена I. (1: 100, Abcam) и анти-GFP (1: 200, Abcam). Вторичные антитела, конъюгированные с Alexa (405, 488, 555, 633/647) (1: 1000, Invitrogen), использовали для выявления сигнала первичного антитела. Ядра окрашивали Hoechst / DAPI, а слайды помещали в Vectashield (Vector).Визуализацию проводили на конфокальном микроскопе Zeiss 780 Upright MP. Для HCR (версия 3) фиксированные сердца залили парафином, срезы 7 мкм депарафинизировали, регидратировали и промывали водой, обработанной DEPC. Окрашивание проводили, как описано ранее 72 . Вкратце, срезы предварительно гибридизовали с буфером для гибридизации зонда в течение 10 мин при 37 ° C, а затем инкубировали с 0,4 пмоль каждого зонда ДНК ( mpeg , col4a1 и col4a3bpa ; Molecular Instruments), разведенных в буфере для гибридизации, покрытом крышкой. с парафильмом и инкубируют в течение ночи при 37 ° C в увлажненной камере.Срезы промывали буфером для промывки зондов и инкубировали 30 мин при комнатной температуре в буфере для амплификации. Шпильки инкубировали при конечной концентрации 6 пмоль каждая (усилитель B3-Alexa594, усилитель B4-Alexa488 и усилитель B5-Alexa647; Molecular Instruments) в течение ночи при комнатной температуре в темной увлажненной камере. Избыточные шпильки промывали смесью 5 × хлорид натрия цитрат натрия / 0,1% твин 20. Срезы отображали на конфокальном микроскопе Zeiss 780 Upright MP. Для визуализации эндогенного коллагена, меченного «трио», Tg (mpeg1: mCherry) gl23 эмбрионов при 6 dpf помещали в 1% легкоплавкую агарозу.Последовательные серии Z-stack были получены с помощью конфокального микроскопа Zeiss 780 Upright MP. Сигнал цитрина возбуждали лазером с длиной волны 514 нм, а mCherry — лазером с длиной волны 561 нм. Для полного иммуноокрашивания фиксированные сердца отбеливали в течение 1 ч в 15% перекиси водорода / PBS, промывали в PBS, содержащем 0,5% тритона-X, и блокировали в 2% BSA в течение ночи при 4 ° C. Первичные антитела против GFP (1:50, Abcam) инкубировали в течение ночи при 4 ° C, промывали в течение длительного времени в PBS, содержащем 0,1% тритона-X. Вторичное антитело, конъюгированное с Alexa 488 (1: 200, Invitrogen), инкубировали в течение ночи при 4 ° C и промывали.Ядра окрашивали Hoechst. Сердца помещали в 1% агарозу с низкой температурой плавления (Sigma) и отображали на микроскопе Zeiss Z1 Lightsheet.

Мышиные сердца фиксировали в течение ночи в 4% PFA при 4 ° C и готовили для криосрезов. Срезы обрабатывали на непрямую иммунофлуоресценцию стандартными методами. В качестве первичных используемых антител были кроличьи анти-коллаген I (Abcam ab34710, разведение 1: 100), крысиные анти-CD68 (Bio-Rad MCA1957, разведение 1: 100), куриные анти-GFP (Abcam ab13970, 1: 100). Во всех случаях использовали вторичные антитела AlexaFluor (Invitrogen, 1: 200).Визуализацию выполняли с помощью конфокального микроскопа Olympus FV1000. Изображения были захвачены и обработаны в цифровом виде с использованием программного обеспечения ImageJ или FIJI (NIH Image, Bethesda, MD).

Гистология и измерения рубцов

Неподвижные сердца рыбок данио залили парафином, срезы 7 мкм депарафинизировали, регидратировали и промывали дистиллированной водой. Кислотный фуксиновый апельсин-G (AFOG) и окрашивание трихромом по Массону проводили 6,73 . Для морфометрического анализа с помощью Axio Scope визуализировали 6 репрезентативных срезов всего сердца для каждого образца.Поляризованный микроскоп A1 с камерой AxioCam HR. Область рубца и поверхность желудочка были разграничены, а площади измерены с помощью программного обеспечения ImageJ. Был рассчитан процент размера рубца по отношению ко всему желудочку.

Мышиные сердца собирали, фиксировали в 4% PFA в течение ночи и либо хранили в PBS, либо заливали в парафиновый воск. Парафиновые срезы размером 10 мкм окрашивали трихромом Массона (Abcam) в соответствии с протоколом производителя. Все изображения были обработаны с помощью программы ImageJ.

Статистический анализ

Для рыбок данио измерения шрамов проводились вслепую. Графики и статистический анализ были созданы с помощью призмы Graphpad, версия 7. Результаты выражены в виде среднего значения ± стандартная ошибка среднего. Мы использовали двусторонний непарный критерий Стьюдента t для всех парных сравнений. Несущественно, p > 0,05; * p <0,05; ** p <0,003; *** р <0,0001. Для мышей статистическую разницу между группами оценивали с помощью двухстороннего непарного теста Стьюдента t или однофакторного дисперсионного анализа.Статистически значимым считалось значение p <0,05. Все значения и графики представляют среднее значение ± SEM.

Сводка отчетов

Дополнительная информация о дизайне исследований доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Редингтон Ремонт | Redington

Отказ от гарантий и ограничение ответственности

В случае повреждения вашей удочки Redington, катушки, куликов, ботинок для болот или одежды, мы незамедлительно отремонтируем или заменим в соответствии с гарантийными обязательствами Redington.

Redington Гарантия

Redington поддерживает продукцию, которую мы производим, и ваше удовлетворение очень важно для нас. Редингтон разрабатывает снаряжение, которое эффективно и максимально эффективно проводит время на природе.

Мы понимаем важность качественного снаряжения, и вы заслуживаете качественной продукции. Если вы не удовлетворены каким-либо продуктом Redington, вы можете вернуть его в соответствии с гарантийной политикой Redington.

ГАРАНТИЯ НА УДИЛИЩ

На каждое новое удилище Redington, приобретенное у официального продавца, за исключением Crosswater Series и Minnow и Topo Combos, распространяется пожизненная гарантия первоначального владельца.На Crosswater, Minnow и Topo распространяется годовая гарантия от дефектов материалов или изготовления, и она должна включать датированный документ, подтверждающий покупку.

Настоящая гарантия ограничивается только заменой стержня и не распространяется на прямые, косвенные, косвенные, случайные или любые другие повреждения, возникшие в результате использования продукта. Эта гарантия не распространяется на неправильное использование, небрежное отношение, нормальный износ, пожар, кражу, потерю или умышленное повреждение. В некоторых штатах не допускается исключение или ограничение случайных или косвенных убытков, поэтому вышеуказанное ограничение или исключение может не относиться к вам.Эта гарантия дает вам определенные юридические права, и вы также можете иметь другие права, которые варьируются от штата к штату.

Redington оставляет за собой право при необходимости заменять модели, снятые с производства, на новые. Цвета оригинальных и запасных частей могут отличаться. Для того, чтобы воспользоваться этой гарантией, первоначальный владелец должен отправить весь продукт Redington, включая сломанные части или части, оплаченный и застрахованный фрахт, по адресу острова Бейнбридж, указанному ниже.

ГАРАНТИЯ НА БАРАБАН

На каждую новую катушку Redington, приобретенную у авторизованного продавца, распространяется гарантия от дефектов материалов или изготовления.Гарантия на катушки Crosswater и Path составляет один год. На все остальные катушки действует пожизненная гарантия первоначального владельца. Товары, возвращаемые по гарантии, должны включать доказательство покупки с датой.

Настоящая гарантия ограничивается только ремонтом или заменой катушки и не распространяется на прямые, косвенные, косвенные, случайные или любые другие повреждения, возникшие в результате использования продукта. Эта гарантия не распространяется на неправильное использование, небрежное отношение, нормальный износ, пожар, кражу, потерю или умышленное повреждение.В некоторых штатах не допускается исключение или ограничение случайных или косвенных убытков, поэтому вышеуказанное ограничение или исключение может не относиться к вам. Эта гарантия дает вам определенные юридические права, и вы также можете иметь другие права, которые варьируются от штата к штату.

Redington оставляет за собой право определять, ремонтировать или заменять какой-либо продукт Redington, на который распространяется данная гарантия, а также право заменять любые модели, снятые с производства, на более новые, если это необходимо. Цвета оригинальных и заменяемых деталей могут отличаться.Чтобы воспользоваться этой гарантией, первоначальный владелец должен отправить весь Продукт Redington, включая сломанные части или части, оплаченный и застрахованный фрахт, по адресу острова Бейнбридж, указанному ниже.

ГАРАНТИЯ НА ВЕЙДЕРЫ И БОТИНКИ

На наши кулики и болотные сапоги предоставляется годовая гарантия от дефектов материалов и изготовления. Любая претензия по данной гарантии должна включать доказательство покупки с датой.

Настоящая гарантия ограничивается только ремонтом или заменой продукта и не распространяется на прямые, косвенные, косвенные, случайные или любые другие повреждения, возникшие в результате использования продукта.Эта гарантия не распространяется на неправильное использование, небрежное отношение, нормальный износ, пожар, кражу, потерю или умышленное повреждение. В некоторых штатах не допускается исключение или ограничение случайных или косвенных убытков, поэтому вышеуказанное ограничение или исключение может не относиться к вам. Эта гарантия дает вам определенные юридические права, и вы также можете иметь другие права, которые варьируются от штата к штату.

Redington оставляет за собой право при необходимости заменять модели, снятые с производства, на новые. Чтобы воспользоваться этой гарантией, первоначальный владелец должен отправить весь продукт Redington, оплаченный и застрахованный фрахт по адресу острова Бейнбридж, указанному ниже.

Все кулики и болотные сапоги необходимо вымыть и очистить перед отправкой продукта обратно в Редингтон .

КАК ПОЛУЧИТЬ РЕМОНТ ИЗДЕЛИЯ REDINGTON?

В случаях, когда гарантия не распространяется, Redington предлагает услуги по ремонту. Redington по своему усмотрению заменит поврежденные детали за определенную плату или выдаст код скидки, который можно использовать на redington.com

. Пожалуйста, прочтите наш Часто задаваемые вопросы по РЕМОНТУ для получения дополнительной информации о том, как отправить ваш продукт на ремонт.

ОБРАТИТЕ ВНИМАНИЕ: некоторые элементы больше не подлежат ремонту.
Если ремонт вашего продукта больше не поддерживается, мы можем выпустить код скидки, который будет использоваться на веб-сайте Redington.com. После проверки продукта нашими техническими специалистами с вами свяжутся и предоставят одноразовый код скидки. Использование этого кода распространяется на любой / весь продукт Redington, доступный на redington.com, независимо от того, какой элемент был отправлен в ремонт.

ДРУГИЕ ВОПРОСЫ?

Если у вас есть дополнительные вопросы, свяжитесь с ремонтной бригадой Redington по телефону 866-498-7243 или напишите нам по электронной почте, заполнив форму Свяжитесь с нами .

Ворон

Все запросы на гарантийные претензии должны подаваться в Raven в течение 30 дней с момента отказа. Пункты, подлежащие рассмотрению по гарантии, должны соответствовать требованиям либо стандартной ограниченной гарантии, либо расширенной гарантии, если возвращаемый продукт был надлежащим образом зарегистрирован. Гарантийная политика кратко изложена ниже.

Гарантия может быть аннулирована, если будет установлено, что компонент установлен в системе, которая не была разработана, изготовлена ​​или одобрена Raven Industries.«Система» включает кабели, датчики или другие устройства, прямо или косвенно подключенные к потенциально гарантийному объекту.

Ограниченная гарантия

Гарантия на продукцию

Raven Applied Technology составляет 12 месяцев с даты розничной продажи. Срок действия ограниченной гарантии ни в коем случае не может превышать 36 месяцев с даты выпуска продукта Raven Industries Applied Technology Division. Эта гарантия распространяется только на первоначального владельца и не подлежит передаче.

Должна быть приложена копия оригинального «Доказательства покупки».

Расширенная гарантия

На продукты

Raven Applied Technology, зарегистрированные через Интернет, распространяется действие гарантии еще на 12 месяцев сверх Ограниченной гарантии, а общий период покрытия составляет 24 месяца с даты розничной продажи. Срок расширенной гарантии ни в коем случае не может превышать 36 месяцев с даты выпуска продукта Raven Industries Applied Technology Division. Эта Расширенная гарантия распространяется только на первоначального владельца и не подлежит передаче.

Гарантия ремонта

Raven дает гарантию на ремонт в течение 12 месяцев с даты возврата последнего ремонта.

Трудовые отношения

Стоимость работ, возвращаемых в течение 12 месяцев с предыдущей даты последнего ремонта, не взимается.

Исключения:

  • Ущерб, причиненный заказчиком — если предмет отправлен в ремонт, повреждение которого вызвано заказчиком.
  • Запрос клиента — если элемент возвращается без фактического сбоя и возвращается для обновлений, оценки, профилактического обслуживания и т. Д.
  • Никаких сбоев не обнаружено — если элемент отправлен в ремонт, который проходит все испытания и сбоев не обнаружено.

Детали

Нет платы за неисправную деталь, которая была заменена в течение 12 месяцев с предыдущей даты возврата после последнего ремонта. Заказчик будет платить за любую деталь, нуждающуюся в замене, которая не была заменена в течение предыдущих 12 месяцев.

Исключения:

  • Ущерб, причиненный заказчиком — если предмет отправлен в ремонт, повреждение которого вызвано заказчиком.
  • Запрос клиента — если элемент отправлен в ремонт, и клиент запрашивает ранее использованную часть по любой причине, кроме фактического отказа.

Послание из будущего II: Годы ремонта

Посмотреть фильм:

Познакомьтесь с командой

Молли Крабапл
Иллюстратор

Ави Льюис
Сценарист и продюсер

Опал Томети
Писатель и рассказчик

Эмма Томпсон
Рассказчик

Гаэль Гарсия Берналь
Рассказчик

Nnimmo Bassey
Рассказчик

Наоми Кляйн
Исполнительный продюсер

Hoda Baraka
Руководитель международного отдела сбыта

Ким Бёкбиндер
Директор, музыка, звуковой дизайн

Джим Батт
Директор

Производитель

Кампании

Видение будущего, описанное в «Послание из будущего II» — это не фантастика: каждая его часть укоренена в реальных требованиях общественных движений, организующихся в наших сообществах и на рабочих местах сегодня .Фильм выпускается в сотрудничестве с невероятной группой организаций, которые борются за завоевание необходимого нам мира. Узнайте об их кампаниях здесь:

Amazon Часы

Amazon Cease Fire

Год назад мир осознал одну из самых страшных экологических катастроф за последнее поколение. Разорение тропических лесов было встречено с беспрецедентной глобальной озабоченностью и заметностью в СМИ, оказав огромное давление на режим Болсонару и вовлекая глобальные компании в катастрофу.Каждый гектар вырубленных и сожженных лесов Амазонки приближает биом и наш климат к критической точке. Между тем дым от пожаров может усугубить ужасные последствия COVID-19 среди коренного населения Бразилии, которое непропорционально сильно пострадало. BlackRock, крупнейший в мире управляющий активами, инвестировал миллиарды долларов в агробизнес и ископаемое топливо, отрасли, вызывающие вторжения на земли коренных народов, захват земель, незаконную вырубку лесов и последующий сезон пожаров в тропических лесах Амазонки.Присоединяйтесь к нам, чтобы привлечь к ответственности BlackRock! Призывайте BlackRock прекратить инвестировать в уничтожение Амазонки и разработать обязательную политику, уважающую права коренных народов, и остановить вырубку лесов!

Подробнее

CODEPINK

Экономика мира

Чтобы положить конец насилию и создать прекрасный мир, в котором мы так долго живем, мы должны радикально переосмыслить и изменить наши отношения, чтобы они определялись любовью, коллективностью и справедливостью. Развитие вашей местной Экономики Мира — это то, как мы можем преобразовать военную экономику, которая убивает нас и нашу планету, в культуру связи и возрождения, в которой нуждается наше будущее и жизнь на планете Земля.Присоединяйтесь к нам на codepink.org/peaceeconomy, мы здесь, чтобы поделиться инструментами и практиками революции ценностей и культуры, которая изменит мир.

Подробнее

Защитники мечты

Молодые люди борются за будущее, которых мы заслуживаем

По всему штату Флорида чернокожие, иммигранты и представители рабочего класса собираются вместе, чтобы потребовать прекращения криминализации наших сообществ. Каждый год наши политики тратят миллионы долларов на охрану и заключение жителей Флориды в тюрьмы, тюрьмы и центры содержания иммигрантов, а также на предоставление налоговых льгот богатым корпорациям, что делает Флориду игровой площадкой для 1%.Между тем в наших общинах нет всего необходимого для выживания. Мы организуем по всему штату Флорида, чтобы восстановить наши сообщества. Это означает, что нам нужно, чтобы наши политики отвлекали деньги от растущих бюджетов полиции и вместо этого инвестировали в ресурсы, которые нам нужны, чтобы оставаться в безопасности и здоровье — здравоохранение, жилье, образование и зеленые рабочие места для всех.

Подробнее

Глобальный союз медсестер

Global Nurses United

Global Nurses United (GNU) стремится усилить борьбу с жесткой экономией, приватизацией, атаками на общественное здравоохранение и работать над безопасным соотношением кадров медсестер и улучшением ухода за пациентами для всех.Это федерация, состоящая из 31 профсоюза медсестер и медицинских работников в 29 странах, объединившихся, чтобы усилить борьбу против жесткой экономии, приватизации и нападок на общественное здравоохранение, а также работать над защитой прав медсестер и работников и улучшением ухода за пациентами. все.

Подробнее

Гринпис Интернэшнл

Кампания за климатическую справедливость

Корпорации, загрязняющие окружающую среду, на протяжении десятилетий продавали колоссальную схему отрицания, чтобы заблокировать значимые действия по борьбе с изменением климата. Людям надоели неограниченные корпоративные злоупотребления.Кампания Гринпис за климатическую справедливость и ответственность работает в знак солидарности с сообществами, стремящимися к справедливости, чтобы поддержать свои требования к достойной жизни.

Подробнее

Хеймаркет Букс

Серия виртуальных живых событий

Haymarket Books — радикальное независимое некоммерческое книжное издательство, базирующееся в Чикаго. Почти 20 лет Хеймаркет издает книги, которые способствуют борьбе за социальную и экономическую справедливость. Запущенная в 2020 году серия виртуальных мероприятий Haymarket в прямом эфире направлена ​​на то, чтобы собрать вместе авторов, организаторов и радикальных мыслителей для важнейших дискуссий о сегодняшних социальных движениях и внести свой вклад в образование и развитие критически настроенных, заинтересованных международных левых сил.

Подробнее

Институт политических исследований

Неравенство и COVID-19

«Этот фильм предлагает трогательную и прямую мысль о том, как мы можем завоевать мир, который нам нужен», — сказал Джон Кавана, исполнительный директор Института политических исследований. «Посредством мощных и убедительных образов« Послание из будущего II: Годы восстановления »показывает, как мы можем превратить моменты неотложного глобального кризиса — от пандемии до потепления климата и системной несправедливости — в катализаторы, требующие и добивающиеся восстановления, прогрессивное видение будущего.Этот фильм, прокладывающий путь от отчаяния к восстановлению, закладывает семена для роста движения вперед, которое может стать непреодолимой силой для добра.

Посредством серии интерактивных диаграмм Институт политических исследований документирует, как пандемия — и неудачные ответные меры политики — усугубляют классовый, расовый и гендерный разрыв. Чтобы завоевать мир, который нам нужен, потребуется обратить вспять это неравенство и разрушить крайнюю концентрацию богатства, которая отравляет нашу демократию и разрушает нашу социальную ткань.

Подробнее

Прыжок

Работа по уходу — это работа с климатом

«Забота друг о друге и забота о планете могут быть самыми быстрорастущими секторами экономики». — Манифест скачка. The Leap сотрудничает с союзниками в секторах низкоуглеродной помощи, таких как медсестринское дело, обучение, непосредственный уход и т. Д., Для разработки видения под руководством работников того, как их отрасли могут быть преобразованы в рамках Зеленого нового курса, и создания мощных средств массовой информации, которые создают поддержку населения. для этой работы.

Подробнее

ДВИЖЕНИЕ 4 ЧЕРНЫХ ЖИЗНИ

Черный Power Rising

Наше движение и общины чернокожих в настоящее время не в состоянии устанавливать масштабные программы, контролировать институты, которые влияют на нашу жизнь, или создавать механизмы для уменьшения вреда. Эту оценку не следует интерпретировать как провал наших социальных движений, но она действительно выявляет критический пробел. Мы создали популярную стратегию, которая поможет нам в следующие пять лет; он основан на преобразующих целях, которые могут повлиять на миллионы черных людей, ищущих направление и лидерство в данный момент.В основном, управление черными и, в конечном итоге, позиционирование наших сообществ для определения повестки дня лежит в основе M4BL Project 2024: Black Power Rising.

Эти пять организационных столпов, каждая из которых имеет свою собственную группу управления чернокожих и партнеров по организации, движут каждой из наших целей «Рост силы черных на 2024 год»: массовое участие, местная власть, объединение движений / многорасовая стратегия, развитие лидерства, избирательная стратегия.

Подробнее

Коллектив NDN

НАЗАД

LANDBACK — это движение, существовавшее на протяжении поколений с долгим наследием организации и жертвоприношения, чтобы вернуть земли коренных народов в руки коренных народов.В настоящее время по всему Черепашьему острову, на севере и юге, идут битвы в ЗЕМЛЕ.

Как коллектив NDN, мы вступаем в это наследие с запуском кампании LANDBACK в качестве механизма для связи, координации, ресурсов и усиления этого движения и сообществ, которые борются за LANDBACK. Закрытие горы Рашмор, возвращение этой земли и всех государственных земель в Блэк-Хиллз, Южная Дакота, — это наша краеугольная битва, из которой мы будем строить эту кампанию.Гора Рашмор не только является международным символом превосходства и колонизации белых, но и находится в самом сердце священных Черных холмов, Хе Сапа. Чтобы по-настоящему разрушить превосходство белых и системы угнетения, мы должны вернуться к корням. Что для нас означает восстановление управления землей.

Подробнее

Проект реагирования на COVID-19 NDN

Проект реагирования на COVID-19 NDN: Проект реагирования на COVID-19 NDN разработан для быстрого предоставления грантов, коммуникаций и стратегической поддержки племенным нациям, передовым организациям, возглавляемым коренными народами, и лицам, которые предоставляют основные услуги общинам коренных народов в Северной Америке. во время текущей глобальной пандемии здоровья.Общий план проекта состоит в том, чтобы предоставить коренным общинам ресурсы реагирования для защиты от экономических воздействий, стрессов на общественные службы и борьбы с распространением дезинформации из-за COVID-19. Этот проект будет поддерживать местные сообщества как в восстановлении после воздействия COVID-19, так и в создании решений для перехода, восстановления и устойчивости.

Подробнее

Международное общественное обслуживание

Платформа «Люди превыше прибыли»

Платформа «Люди превыше прибыли» (POP) — это глобальная онлайн-платформа для создания кампаний и библиотека знаний, предназначенная для усиления сопротивления приватизации и борьбы за универсальные качественные общественные услуги.Местные активисты, союзы и союзники могут использовать платформу для разработки своих кампаний, обмена успешными стратегиями и использования глобальной солидарности.

Создано Public Services International — глобальной федерацией профсоюзов работников государственной службы. Целью POP является объединение организаций, борющихся с приватизацией, расширение прав и возможностей участников кампаний, обмен передовым опытом и предоставление инструмента для анализа тенденций приватизации и ремуниципализации.

Подробнее

Движение восхода солнца

Школа Санрайз

Присоединяйтесь к нам в Sunrise School: онлайн-сообществе, чтобы развить навыки и силу, которые нам нужны, чтобы противостоять кризисам, с которыми мы сталкиваемся.Независимо от того, являетесь ли вы новичком в этом движении и хотите сделать первые шаги, чтобы принять в нем участие, или вы опытный лидер хаба Sunrise, желающий улучшить свои навыки для следующего действия, вы попали в нужное место! В Sunrise School мы дадим вам навыки, ресурсы и поддержку, необходимые для того, чтобы действовать и стать лидером нашего движения.

Подробнее

В ДЕНЬ

Рост на один миллиард

Каждая третья женщина на планете будет избита или изнасилована в течение своей жизни.Это ОДИН МИЛЛИАРД ЖЕНЩИН И ДЕВОЧЕК. Каждый год в феврале мы поднимаемся — в странах по всему миру — чтобы показать нашим местным сообществам и миру, как выглядит один миллиард, и пролить свет на безнаказанность и несправедливость, с которыми чаще всего сталкиваются выжившие. Мы поднимаемся с помощью танца, чтобы выразить радость и общность, а также отметить тот факт, что мы не были побеждены этим насилием. Мы поднимаемся, чтобы показать, что мы полны решимости создать новый вид сознания — такое, в котором насилию будет сопротивляться до тех пор, пока оно станет немыслимым.

Подробнее

Ремонт авто столкновений (2 года) | Highland Community College

Программа Auto Collision Repair Technology в Техническом центре Highland Community College не случайна!

Вы любите ремонтировать автомобили? Сделайте карьеру в качестве специалиста по ремонту автомобильных аварий в техническом центре Highland Community College. Студенты дневной формы обучения могут планировать поступление на работу после завершения 18 месяцев курсовой работы.

Студенты получат практический опыт, работая над чем угодно, от мелких вмятин на парковке до полного Ford Mustang.У нас есть ультрасовременная окрасочная кабина для черновой окраски, компьютерное оборудование для выравнивания и обширный инвентарь электроинструментов. У выпускников программы Auto Collision Repair есть вакансии в области ремонта кузова, покраски, оценки и оценки повреждений при столкновении.

Национальный институт качества автомобильного обслуживания (ASE) предлагает сертификацию начального уровня ремонта и восстановления после столкновений. Ближе к концу программы студенты пройдут сертификационные тесты ASE начального уровня.

Начни свою карьеру сегодня же! Свяжитесь с представителем приемной комиссии, чтобы запланировать экскурсию по телефону 913-367-6204.

Вот несколько полезных ресурсов:

Первый семестр Кредиты
ACR105 Лакокрасочные материалы I 3
ACR115 Ремонт неконструкционных АиП I 4
ACR125 Структурный ремонт и ремонт I 2
ACR135 Аэрограф, стекловолокно и тонкая полоска 3
Итого за первый семестр 12
Второй семестр
ACR155 Краска и ремонт II 3
ACR165 Ремонт внеструктурных систем A&D II 4
ACR175 Structural A&D Repair II 2
ACR185 Производство панелей 3
Итого за второй семестр 12
Итого за первый год 24
Третий семестр
ACR205 Лакокрасочные материалы III 3
ACR215 Неструктурный ремонт A&D III 4
ACR225 Структурный ремонт A&D III 3
ACR235 Автопарк и коммерческие автомобили 3
Итого за третий семестр 13
Четвертый семестр
ACR255 Краска и ремонт IV 4
ACR265 Неструктурный ремонт A&D IV 5
ACR275 Структурный ремонт и ремонт IV 3
ACR285 Механическое и электрическое оборудование 3
Итого за четвертый семестр 15
Итого за второй год 28
Всего кредитов для сертификата 52
факультативный
ACR295 Трудовой стаж

Восстановление игрового клиента — поддержка Guild Wars 2

Если у вас возникли проблемы с запуском Guild Wars 2 , архив данных мог быть поврежден.Это может привести к сбоям, отключениям и другим проблемам, которые нарушают вашу способность играть и которые необходимо исправить, прежде чем игра запустится должным образом.

Выполните следующие действия, чтобы проверить и восстановить свой игровой архив:

Выполните следующие действия, если вы запускаете игру в операционной системе Windows:

  1. Найдите файл Gw2.exe .
  2. Щелкните файл правой кнопкой мыши и выберите Создать ярлык .
  3. Переименуйте этот новый ярлык в Guild Wars 2 Repair .
  4. Щелкните правой кнопкой мыши Guild Wars 2 Repair и выберите Properties .
  5. Найдите строку Target и добавьте в конец –repair . ( Пример: «C: \ Games \ Guild Wars 2 \ gw2.exe» — ремонт)
  6. Нажмите ОК .

Теперь дважды щелкните ярлык Guild Wars 2 Repair . Это начнет автоматически восстанавливать ваш игровой клиент. После завершения игра запустится.

ПРИМЕЧАНИЕ : Имейте в виду, что процесс проверки и восстановления будет запускаться каждый раз, когда вы дважды щелкаете ярлык Guild Wars 2 Repair ; если вы хотите играть в игру, не восстанавливая архив, дважды щелкните Gw2.exe или другой ярлык без команды -repair в строке «Цель».

Другие проблемы клиентов и решения


Если у вас по-прежнему возникают проблемы с запуском клиента (или возникают проблемы в процессе восстановления), попробуйте выполнить следующие шаги по устранению неполадок:

Это могло быть вызвано несколькими проблемами с вашим игровым клиентом. Вот несколько вещей, которые нужно проверить:

Вы администратор своего компьютера или Windows Vista / 7?

Вам могут потребоваться права администратора для запуска клиента или доступа к папке, в которой находится ваш игровой клиент.Попробуйте запустить Gw2.exe , щелкнув файл правой кнопкой мыши и выбрав Запуск от имени администратора .

Папка, содержащая игру, настроена на «Только чтение»?

Клиенту необходимо добавить файлы в папку с игрой, прежде чем она сможет работать должным образом. Чтобы убедиться, что он может вносить изменения, щелкните правой кнопкой мыши папку Guild Wars 2 и выберите Свойства . Отсюда снимите флажок «Только для чтения» и щелкните левой кнопкой мыши Ok , чтобы сохранить изменения.

Вы недавно обновляли драйверы видеокарты?

  • Пользователи AMD могут найти последние версии драйверов для своей видеокарты здесь.
  • Пользователи Nvidia могут найти последнюю версию драйвера для своей видеокарты здесь.

Установлен ли у вас пакет обновления 1 для Windows 7?

Guild Wars 2 не поддерживается без этого пакета обновления. Во многих случаях загрузка пакета обновления помогла решить проблемы, которые препятствуют запуску игры или вызывают ее сбой.

Посетите http://windowsupdate.microsoft.com/, чтобы загрузить и установить все отсутствующие важные обновления.

У вас установлен DirectX 9?

Подобно пакету обновления, Guild Wars 2 требует установки DirectX 9, прежде чем он будет работать должным образом. Вы можете скачать последние версии драйверов DirectX 9.0c здесь: https://www.microsoft.com/en-us/download/details.aspx?id=35

  • Сначала найдите и удалите локальный файл .dat , который находится в папке Documents> Guild Wars 2 .
  • Затем перезагрузите компьютер и снова запустите Guild Wars 2 . После появления сообщения «Остался 1 файл» должен включиться дополнительный протокол для загрузки недостающего файла из системы резервного копирования. Обычно этот процесс занимает около 10 минут.
  • Если через 15 минут вы обнаружите, что описанный выше процесс не устранил проблему, то есть вы все еще застряли на 99% загрузке, попробуйте следующее решение:

    Измените настройку языка для средства запуска (в в правом верхнем углу экрана) на другой язык; это должно заставить загрузку завершиться.Как только это произойдет, верните в программу запуска свой исходный язык и войдите в систему в обычном режиме.

Если восстановление клиента не решило вашу проблему, вы также можете попробовать очистить временные файлы в кэше игры. Вы можете сделать это, выполнив следующие действия:

  1. Откройте обозреватель Windows.
  2. На панели навигации введите % temp% , чтобы открыть временную папку.
  3. Найдите все папки, которые начинаются с « gw2cache- », за которым следует строка чисел.
  4. Удалите эти папки.
  5. Открыть Guild Wars 2 .

Хотя вам нужно будет повторно загрузить все файлы, необходимые для запуска игры, этот процесс поможет заменить любые поврежденные файлы, которые могут оставаться в кэше вашей игры.

Да, это нормально. Эти файлы представляют собой самые последние данные и файлы содержимого в игре, и они необходимы для игры Guild Wars 2 .

«Сборка» — это технический термин, обозначающий определенную версию игры.Поскольку Guild Wars 2 часто обновляется новым контентом, а также исправляет случайные ошибки, каждый месяц может быть доступно несколько новых сборок.

Каждый раз, когда мы распространяем новую сборку, она автоматически предлагает вам выйти из игры (ваш прогресс сохраняется до выхода) и загрузить последние файлы. При следующем запуске клиента все необходимые файлы автоматически загрузятся в вашу систему. Во многих случаях вы сможете снова войти в игру почти сразу, но иногда вам нужно немного подождать, прежде чем снова присоединиться к игре.

Вы можете прочитать подробности того, что было изменено в каждом обновлении игры, на нашем официальном форуме.

Наиболее вероятно, что ваш файл Gw2.dat каким-то образом был поврежден — либо при загрузке игры, либо из-за сбоя.

  • Сначала попробуйте повторно загрузить файл данных игры, переименовав текущий файл Gw2.dat (находится в папке установки) в Gw2.old и снова запустите программу запуска. Это создаст «резервную копию» вашего файла и позволит вам загрузить новую рабочую копию игры.
  • Кроме того, вы можете убедиться, что ваша папка GW2 не установлена ​​в каталог Program Files . Мы рекомендуем C: \ Games \ GW2 или что-то подобное.
  • Если проблема не устранена, возможно, у вас проблемы с оборудованием или фоновые приложения могут быть причиной повреждения файла. Посетите наши форумы технической поддержки, чтобы узнать, сможете ли вы найти решение вашей конкретной проблемы, или начните обсуждение, указав местоположение вашей папки GW2.

    Вы также можете отправить заявку в службу технической поддержки, чтобы наша группа поддержки могла помочь в исследовании проблемы.

ПРИМЕЧАНИЕ : Если вы получаете ошибку 502 при попытке доступа к форуму, повторите попытку позже.

  • Эта проблема обычно вызвана вашим брандмауэром, который может блокировать вашу возможность подключения к серверам ArenaNet. Мы рекомендуем отключить брандмауэр перед запуском игры, чтобы определить, решит ли это проблему.
  • Также возможно, что другая программа или программа безопасности мешает подключению вашей игры. Исторически сложилось так, что программы безопасности, такие как AVG, Norton и McAfee, были проблематичными, блокируя подключение игроков к нашим серверам. Попробуйте временно отключить антивирусное программное обеспечение и повторно подключиться к игре. Если это поможет решить вашу проблему, вам может потребоваться настроить это программное обеспечение, чтобы в будущем не блокировать Guild Wars 2 .
  • Кроме того, убедитесь, что вы запускаете установку от имени администратора.

Щелкните правой кнопкой мыши ярлык клиента и выберите Свойства . В командной строке Target вы должны увидеть -mce , помеченный в конце пути к ярлыку; удалите тег — mce и щелкните левой кнопкой мыши на , примените , чтобы сохранить изменения. Это должно решить проблему!

После обновления игры серверу может потребоваться еще минуту или две, чтобы завершить загрузку файлов игры на стороне сервера. Если обновление или патч только что прошли, подождите несколько минут, а затем попробуйте снова войти в систему.

Вы можете настроить текст и язык аудио для Guild Wars 2 во внутриигровом меню опций. Чтобы внести эти изменения, вам нужно будет войти в игру, используя любого персонажа. После входа в систему выполните следующие действия:

  1. Нажмите F11 , чтобы открыть меню Общие параметры .

  2. Измените первые два раскрывающихся меню на язык по вашему выбору.

ПРИМЕЧАНИЕ : Каждый языковой параметр отображает альтернативные языки на его родном языке.Например, в зависимости от языковых настроек вариант для английского языка представлен как English, Anglais, Inglés или Englisch. Выбор любого из этих параметров включит английский текст и звук, а также изменит меню параметров на английский.

Существует ряд различных факторов, которые могут вызвать эту проблему.

  • Во-первых, исключите возможность того, что ваш маршрутизатор вызывает проблемы, путем обхода маршрутизатора и прямого подключения к модему через кабель Ethernet.Если у вас есть комбинированный маршрутизатор / модем, отключите настройку SPI Firewall — это, как известно, способствует появлению черных экранов.
  • Если это не решит проблему для вас, следует учитывать еще один фактор — ваше программное обеспечение безопасности. В качестве временного шага по устранению неполадок отключите любое программное обеспечение безопасности, чтобы проверить, не мешает ли оно работе клиента. Если это поможет решить вашу проблему, вам может потребоваться настроить это программное обеспечение, чтобы оно не блокировало Guild Wars 2 в будущем.
  • Кроме того, если вы по-прежнему испытываете проблемы с черным экраном, отправьте заявку в службу технической поддержки для получения дополнительной помощи.

NEBNext® Ultra ™ II End Repair / dA-Tailing Module

Модуль NEBNext Ultra II End Repair / dA-Tailing был оптимизирован для преобразования 500 пг-1 мкг фрагментированной ДНК в восстановленную ДНК, имеющую 5′-фосфорилированные концы с 3′-dA-хвостами. Модуль оптимизирован для использования с модулем лигирования NEBNext Ultra II (NEB # E7595) и является частью рабочего процесса Ultra II DNA, который обеспечивает получение высококачественных библиотек с высоким выходом от 500 пг до 1 мкг исходной ДНК.

Этот модуль совместим с рабочими процессами Illumina и несколькими рабочими процессами Oxford Nanopore Technologies.

Для создания библиотеки Illumina модуль NEBNext Ultra II End Repair / dA-Tailing разработан для использования со следующими компонентами:

• Модуль лигирования NEBNext Ultra II (NEB # E7595)
• NEBNext Ultra II Q5 ® Master Mix (NEB # M0544)
• Олиго NEBNext для Illumina (NEB # E7335, # E7500, # E7710, # E7730, # E6609, # E7600 # E7535, # E7350)

Для использования с NEBNext Multiplex Oligos для Illumina (уникальный двойной индекс Набор ДНК адаптеров UMI 1) (NEB # E7395), обратитесь к вкладке «Протоколы» для получения инструкций по конкретным адаптерам UMI.

Функциональная проверка

Каждый набор реагентов функционально проверяется вместе путем создания и секвенирования библиотеки транскриптомов и секвенирования в библиотеке ДНК на платформе для секвенирования Illumina,

Lot Control

Предоставленные партии управляются отдельно и проходят дополнительную функциональную проверку. Отдельные реагенты проходят стандартную ферментативную активность и тесты контроля качества, а также соответствуют строгим критериям дополнительных проверок качества, перечисленных на странице каждого отдельного компонента

Поставляемые реагенты

В комплект поставки данного продукта входят следующие реагенты:

NEB # Название компонента Компонент № Хранится при (° C) Количество Концентрация
Категории продукта:
Продукты для подготовки библиотеки ChIP-seq,
Продукты для подготовки библиотеки ДНК
Приложения:
Препарат библиотеки ДНК NEBNext® Ultra ™ II,
Подготовка библиотеки ДНК,
Подготовка проб NGS и обогащение мишени,

Подготовка библиотеки Illumina

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *